D. Canale, C. Caglieresi, C. Moschini, C. D. Liberati, E. Macchia, A. Pinchera and E. Martino.
Department of Endocrinology and Metabolism, University of Pisa, Pisa, Italy.
Correspondence: D. Canale, Dipartimento di Endocrinologia, Universita di Pisa, Ospedale di Cisanello, via Paradisa, 2, 56124 Pisa, Italy. Fax: + 39 050 995001; E-mail: d.canale@tin.it.
Summary
Objective: Polymorphism of the androgen receptor (AR) has been related to various pathophysiological conditions, such as osteoporosis and infertility. The objectives of this study were to evaluate the frequency of distribution in a normal Italian population and to assess CAG repeats (CAGr) in other conditions, such as hypoandrogenism, potentially influenced by AR polymorphism.
Patients and measurements: CAGr polymorphism was determined in a group of 91 healthy normoandrogenized subjects, 29 hypoandrogenized patients (hypoplasia of prostate and seminal vesicles, reduced beard or body hair, etc.) and 29 infertile patients by direct sequencing.
Results: The mean (± SD) number of CAG repeats [(CAGr)n] was 21·5 (± 1·7) in the control group, 21·4 (± 2·0) in the infertile patients and 24·0 (± 2·9) in the hypoandrogenic males. The difference was statistically significant between this last group and the other two (P < 0·0001), while there was no difference between normal controls and infertile patients. The frequency distribution showed a shift towards higher CAG length in hypoandrogenized patients compared to controls and infertile patients. If we used a cut-off point of 24·9 (2 SD above the mean), the percentage of patients with 25 or more CAGr repeats was 38% among hypoandrogenized patients, 7% among infertile patients and 5% among the control group. In hypoandrogenized subjects (CAGr)n correlated slightly with testis and prostate volume. The number of CAG repeats was not associated with any of the hormonal parameters, including testosterone, evaluated in the three groups.
Conclusions: Our normal population, representing subjects from Central Italy, is superimposable on other European populations with regard to (CAGr)n distribution. Hypoandrogenic males have a shift in the frequency distribution towards longer (CAGr)n. Infertile patients are not statistically different from the control group. These findings suggest that, given the same amount of circulating testosterone, as in our hypoandrogenized and control group, the final net androgenic phenotypical effect is due to AR polymorphism.
(Received 23 December 2004; returned for revision 2 February 2005; finally revised 14 March 2005; accepted 13 July 2005).
Introduction
Testosterone (T) effects are mediated through the androgen receptor (AR), a nuclear receptor belonging to the superfamily of steroid and thyroid hormone receptors.[1-3] This receptor is characterized by the presence of a variable number of glutamine residues in the NH2terminal domain. These residues are encoded by a variable number of CAG repeats [(CAGr)n] in the first exon of the gene. The (CAGr)n is inversely associated with the transcriptional activity of T target genes: that is, the higher the (CAGr)n, the lower the transcriptional activity and vice versa.[4,5] This started with the discovery that Kennedy’s disease (a spinobulbar muscular atrophy) was characterized by a marked increase in (CAGr)n (beyond 37) and a hypoandrogenic status.[6] Following this report, the (CAGr)n has been analysed in a variety of cross-sectional studies, investigating its influence on clinical conditions and parameters affected by T action, such as bone density,[7] spermatogenesis,[8] mood variations, cognitive functions and pre-Alzheimer conditions,[9,10] and hair development in both men and women.[11] Recently, Zitzmann et al.[12] have correlated the prostate growth induced by T replacement therapy in hypogonadal men with (CAGr)n in a longitudinal pharmacogenetic study, demonstrating an impressive modulating effect by the CAGr polymorphism.
A role of the (CAGr)n has been hypothesized in determining the androgenicity of an individual.[12] This study was undertaken to evaluate the (CAGr)n in a series of patients with characteristics of hypoandrogenic traits and compare them with a group of normal controls and infertile patient.
Subjects and methods
Subjects
One hundred and forty-nine Italian (Caucasian race, mainly from Central Italy) subjects were included in this study. The control group comprised 91 normal fertile subjects without any history of gonadal disease and with normal bone mineral density and body hair distribution. The others (n = 58) were selected from patients referred to the andrology outpatient clinic of our department.
Twenty-nine were infertile according to this definition: 2 years of attempted conception in a stable couple relationship and at least one seminal parameter (concentration and/or motility) below World Health Organization (WHO) criteria.[13] They underwent semen analysis, scrotal ultrasound, prostate transrectal ultrasound whenever necessary, and hormonal assessment of FSH, LH, PRL and testosterone. In cases of severe oligospermia or azoospermia they underwent karyotyping and screening for microdeletions of the Y chromosome.
The other 29 were hypoandrogenized, with reduced facial or body hair, prostate or vesicular or epididymal hypoplasia, penile recurvatum. Body hair pattern was categorized by experienced clinicians according to the four-point scale proposed by Zitzmann et at.[14] (feminine = 1, scantly male = 2, normal male = 3, extraordinarily male = 4).
Among the patients of this last group none had testosterone plasma values below 8·67 nmol/l (2·5 ng/ml) and reduced testes volume. In those patients with a clinical suspicion of prostate or vesicular or epididymal hypoplasia this was confirmed by ultrasound, both scrotal and transrectal. In these same patients analysis of the CFTR gene was performed to exclude mutations or deletions.
Methods
Semen analysis
At least two semen analyses were performed according to WHO guidelines. Patients were considered infertile if the concentration fell < 20 x 106/ml and progressive motility (classes a + b) < 50%. Sperm morphology was analysed, but not considered in this evaluation unless the sperm morphology was < 20%, as in our laboratory the percentage of normal forms in a fertile population was 25 ± 2·1%.
Ultrasound
Scrotal ultrasound was performed with a 7·5 MHz linear probe with a transducer length of 45 mm (to allow a precise evaluation of the longitudinal axis) (Esaote, Genua, Italy). To evaluate testis volume the ellipsoid formula (π/6 x a x b x c, where a, b and c are the three axes of the testis) was used. Prostate and seminal vesicle evaluation was performed with an abdominal 3·5 MHz and a transrectal 7·5 MHz transducer: the formula used for assessment of prostate volume was the same as above. The ultrasound examinations were performed by one of the authors, highly experienced in the field.[15]
Hormone assays
Serum FSH, LH, T and PRL were measured by chemiluminescence (Beckman Coulter Access with Unicel™ DXI 800 Access Immunoassay System, Beckman Coulter). The intra-assay and interassay coefficients of variation (CVs) were, respectively, for FSH 3·3 and 5·0%; for LH 5·1 and 6·6%; for T 2·9 and 6·2% and for PRL 2·8 and 7·0%.
Molecular biology (genetic analyses)
Screening of microdeletions in the 56 interval of the Y chromosome was performed according to the European Academy of Andrology (EAA) and European Molecular Genetics Quality Network (EMQN) guidelines,[16] recently revised.[17] The following Y-specific sequence tagged sites were analysed: 84 and 86 (AZFa), 127 and 134 (AZFb), 254 and 255 (AZFc). As control, amplification of SRY (sY14) and ZFX/ZFY genes was performed.
Screening of the most common CFTR gene mutations (n = 31) was performed by multiple polymerase chain reaction (PCR).
Determination of (CAG)n
Genomic DNA was extracted from peripheral blood lymphocytes using a DNA blood mini kit (Quiagen, Oslo, Norway). The AR exon 1 region encoding the polyglutamine repeat was amplified using PCR. The primers used in the present study were AR1 (5'TGCGCGAAGTGATCCAGAAC3') and AR2 (5'GCTGTGAAGGTTGCTGTTCCTCAT3'). PCR amplification was performed in a final volume of 50 |ll containing 0·2-0·5 μg of DNA template, Taq Buffer 10x (Promega, Madison, WI, USA), MgCl2 25 mM (Promega), dNTP 10 mM (Promega) 1·25 units of Taq polymerase (Promega) and 50 pmol of each primer.
The thermal cycling profile on PTC200 (Peltier Thermal Cycler) consists of a 10-s denaturation step at 94 °C, a 45-s annealing step at the optimized temperature of 60 °C and a 20-s extension step at 72 °C for a total of 35 cycles. Each PCR was initiated with a 2-min denaturation step at 94 °C, terminating with a 10-s extension step at 72 °C and 4 °C permanently. The PCR-amplified products were loaded on agarose gel 1% for electrophoresis and purified with a Jetquick purification kit (Genomed, GmbH, Löhne, Germany).
The PCR-amplified products were subjected to direct sequencing, which was performed using a BigDye™ Terminator Sequencing Kit (Applied Biosystems, Foster City, CA, USA) and a Genetic Analyser PRISM™ 310 (Applied Biosystems). All samples were screened by this method.
Informed consent
Informed consent was obtained from each patient or volunteer according to Italian legislation.
Statistical analysis
All variables were checked for normal distribution by the Kolmogorov-Smirnov one-sample test for goodness-of-fit. Analysis of variance (ANOVA) was used for intergroup comparison and when P < 0·05 post-hoc tests were applied (Scheffe). Multiple regression was used for comparison between (CAGr)n and hormonal and clinical parameters.
Results
The main characteristics of the three groups are shown in Table 1. Confirming the selection criteria, body hair pattern was different in hypoandrogenized and control subjects. T and particularly FSH levels differed markedly between infertile patients and the other two groups; LH differed only between infertile and controls. This was probably due to the presence of patients with severe testicular damage among the infertile patients. The mean (± SD; SE) (CAGr)n was 21·5 (± 1·7; 0·1) in the control group, 21·4 (± 2·0; 0·3) in the infertile patients and 24·0 (± 2·9; 0·5) in the hypoandrogenic males. The difference was statistically significant between this last group and the other two (P < 0·0001), while there was no difference between normal controls and infertile patients. The frequency distribution shows a significant trend in hypoandrogenized patients towards higher (CAGr) length (Fig. 1). The 90th percentiles in hypoandrogenized, infertile and control subjects were 29·0, 24·0 and 23·4, respectively. If we used a cut-offpoint of 24·9 (2 SD above the mean), the percentage of patients with 25 or more (CAGr)n among hypoandrogenic men was 38%, among infertile patients 7% and among the control group 5%.
Table 1. Main characteristics of the three populations studied
Figure 1. Frequency distribution of number of CAG repeats among 91 normal controls, 29 hypoandrogenic males and 29 infertile patients. A shift towards longer CAG repeats is seen in hypoandrogenized patients compared to infertile men and the control group.
The (CAGr)n did not correlate with any of the hormonal parameters evaluated (FSH, LH, T and PRL) in any of the three groups (Table 2). Specifically, the (CAGr) length was not associated with T serum levels in the hypoandrogenic males (Fig. 2). In the hypoandrogenized group an inverse correlation between (CAGr)n and testis (P = 0·04) and prostate (P = 0·05) volume was found at the limit of significance.
Table 2. Correlation between length of CAG repeats and clinical, hormonal and ultrasound parameters (multiple regression)
Figure 2. Testosterone levels in relation to CAGr length of the AR gene of hypoandrogenized patients. Simple regression is given (P = 0-63).
Discussion
Various recent reports have stressed the importance of AR polymorphism and particularly the (CAGr)n, in determining different pathophysiological conditions, such as bone metabolism, prostate development and cancer, hair development, and neurological disorders.[18] The AR operates as a ligand-inducible transcription factor that mediates the expression of target genes in response to specific ligands. The NH2-terminal domain is the most variable among nuclear receptors in terms of both length and sequence. There are two discrete regions within the NH2-terminus that contribute to transactivation. The full-length receptor requires a region primarily located between amino acids 141 and 338 for full ligand-inducible transcriptional activity.[19,20] This region contains a polymorphic polyglutamine repeat that ranges from 8 to 31 repeats in normal individuals, with a modal length of 20.[21,22] Longer polyglutamine tract length results in decreased AR transcriptional activity in vitro.[23,24]
The biological substrate of these correlations is represented by the modifications of binding with coactivators, transcription factors and corepressors determined by CAGr length. The polyglutamine tract forms part of the interaction surface for the AR coactivator ARA24 and expansion of the polyglutamine tract from 25 to 49 repeats results in a reduction of AR-ARA24 interactions, possibly because the expanded glutamine repeats result in an abnormal conformation of the AR NH2-terminal.[25,26]
The mean, median and frequency distribution among our normal population was superimposable on the series of Harkonen et al.[27] in Finnish men, although our range was narrower.[18-26] Therefore, we have shown that the Italian population, in this case of Central Italy, is comparable to other European populations, at least concerning this specific genetic aspect.[28,29]
Our data demonstrate for the first time that hypoandrogenic traits, such as hypoplasia of prostate and seminal vesicles, and reduced beard and body hair, are characterized by a shift in the frequency distribution of (CAGr)n towards a prevalence of longer repeats. It might be that, given the same amount of circulating T, as in our hypoandrogenized and control groups, the final net androgenic phenotypical effect is due to the AR polymorphism. This would support the hypothesis that it is not the ligand, that is T, that determines androgenicity, but the interrelation between the polyglutamine surface of AR and coactivators, such as ARA24.[26] The work by La Spada et al[6] showed the extreme of this pattern with very significant hypoandrogenic traits associated with very long (CAGr)n as those found in patients with Kennedy’s syndrome. Similar findings were recently described in a very elegant study by Zitzmann et al.[14] in Klinefelter patients. In these patients longer CAG repeats were associated with lower bone density, increased height, gynaecomastia, lower professional achievement and a lower tendency to form a stable couple relationship. The inverse correlation between (CAGr)n and testis volume found by these authors was partially confirmed by our data. A possible explanation for this finding is that, given sufficient gonadotrophic stimulation and normal Leydig cell responsiveness, T action on the testis itself, as for any other target organ, is mediated by AR polymorphism in the long term, as hypothesized previously by Zitzmann et al.[14] Another specific target of androgen action, that is the prostate (volume), shows a significant difference between hypoandrogenized patients and controls. As this difference cannot be ascribed to a variance in T levels, is most probably related to AR polymorphism. The lower (compared to testis volume) correlation between (CAGr)n and prostate volume in hypoandrogenized subjects is probably due to the lower number of cases analysed and the wider range.
Concerning the infertile population, even if this was not the aim of our work, our data, in a reduced number of patients, support the hypothesis that this clinical condition does not correlate with the length of (CAGr)n, as shown previously by Rajpert-De Meyts et al.[30] and Thangaraj et al.[31] and in disagreement with the findings of Tut et al[32] In fact our infertile population shows a broad frequency distribution (see Fig. 1), with peaks at 20 and 24-25 CAG repeats, demonstrating the heterogeneity of this population. It is likely that within this group of patients single cases could be related to polymorphism of the AR, but the latter does not seem to be a major determinant of male infertility.
Prospectively, the assessment of (CAGr)n in every patient with an andrological disease could provide some indication of the pathophysiological causes of that condition. As shown by Zitzmann et al[12] in their work on hypogonadal patients and the correlation between (CAGr)n and prostate volume, a preliminary assessment of (CAGr)n could guide therapeutic modalities (the frequency and amount of exogenous androgens). For example, prescribing exogenous T in a patient with a serum T level in the lower normal range or slightly reduced, but with (CAGr)n in the lower end of the curve, could be of no benefit for the parameter the clinician would like to treat, such as bone density or erectile dysfunction, and could even be dangerous at the prostatic level. Conversely, as suggested by Zitzmann et at.,[14] early treatment of Klinefelter patients with longer (CAGr)n could help them to achieve an adequate androgenicity during a particular period of life, such as pubertal development, when some physical and psychological parameters are heavily influenced by the androgenic milieu.
Acknowledgements
This work was partially support by a grant from the Italian Ministry of Education and Research (MIUR), prog. COFIN.
References
Brinkmann, A.O. (2001) Molecular basis of androgen insensitivity. Molecular and Cellular Endocrinology, 179, 105-109.
Lee, Y.F., Lee, H.J. & Chang, C. (2002) Recent advances in the TR2 and TR4 orphan receptors of the nuclear receptor superfamily. Journal of Steroid Biochemistry and Molecular Biology, 81, 291-308. Review.
Molenda, H.A., Kilts, C.P., Allen, R.L. & Tetel, M.J. (2003) Nuclear receptor coactivator function in reproductive physiology and behavior. Biology of Reproduction, 69, 1449-1457.
Chamberlain, N.L., Driver, E.D. & Miesfeld, R.L. (1994) The length and location of CAG trinucleotide repeats in the androgen receptor N-terminal domain affect transactivation function. Nucleic Acids Research, 11, 3181-3186.
Beilin, J., Ball, E.M., Favaloro, J.M. & Zajac, J.D. (2000) Effect of the androgen receptor CAG repeat polymorphism on transcriptional activity: specificity in prostate and non prostate cell lines. Journal of Molecular Endocrinology, 25, 85-96.
La Spada, A.R., Wilson, E.M., Lubahn, D.B., Harding, A.E. & Fischbeck, K.H. (1991) Androgen receptor gene mutations in Xlinked spinal and bulbar muscular atrophy. Nature, 352, 77-79.
Van Pottelbergh, I., Lumbroso, S., Goemaere, S., Sultan, C. & Kaufman, J.M. (2001) Lack of influence of the androgen receptor gene CAG-repeat polymorphism of sex steroid status and bone metabolism in elderly men. Clinical Endocrinology, 55, 659-666.
Milatiner, D., Halle, D., Huerta, M., Margalioth, E.J., Cohen, Y., Ben-Chetrit, A., Gal, M., Mimoni, T. & Eldar-Geva, T. (2004) Associations between androgen receptor CAG repeat length and sperm morphology. Human Reproduction, 19, 1426-1430.
Lehmann, D.J., Butler, H.T., Warden, D.R., Combrinck, M., King, E., Nicoll, J.A., Budge, M.M., De Jager, C.A., Hogervorst, E., Esiri, M.M., Ragoussis, J. & Smith, A.D. (2003) Association of the androgen receptor CAG repeat polymorphism with Alzheimer’s disease in men. Neuroscience Letters, 340, 87-90.
Everett, C.M. & Wood, N.W. (2004) Trinucleotide repeats and neurodegenerative disease. Brain, 127, 2385-2405.
Ibanez, L., Ong, K.K., Mongan, N., Jaaskelainen, J., Marcus, M.V., Hughes De Zegher, F. & Dunger, D.B. (2003) Androgen receptor gene CAG repeat polymorphism in the development of ovarian hyperandrogenism. Journal of Clinical Endocrinology and Metabolism, 88, 3333-3338.
Zitzmann, M., Depenbusch, M., Gromoll, J. & Nieschlag, E. (2003) Prostate volume and growth in testosterone-substituted hypogonadal men are dependent on the CAG repeat polymorphism of the androgen receptor gene: a longitudinal pharmacogenetic study. Journal of Clinical Endocrinology and Metabolism, 88, 2049-2054.
World Health Organization (1999) Laboratory Manual for the Examination of Human Semen and Sperm-Cervical Mucus Interaction, 4th edn. Cambridge University Press, Cambridge.
Zitzmann, M., Depenbusch, M., Gromoll, J. & Nieschlag, E. (2004) X-chromosome inactivation patterns and androgen receptor functionality influence phenotype and social characteristics as well as pharmacogenetics of testosterone therapy in Klinefelter patients. Journal of Clinical Endocrinology and Metabolism, 89, 6208-6217.
Canale, D., Mais, V., Turchi, P., Andreini, F., Melis, G.B. & MenchiniFabris, G.F. (1990) Ultrasound monitoring of testis and prostate maturation in hypogonadotropic hypogonadic males during gonadotropin-releasing hormone treatment. Fertility and Sterility, 53, 537-540.
Simoni, M., Bakker, E., Eurlings, M.C., Matthijs, G., Moro, E., Muller, C.R. & Vogt, P.H. (1999) Laboratory guidelines for molecular diagnosis of Y-chromosomal microdeletions. International Journal of Andrology, 22, 292-299.
Simoni, M., Bakker, E. & Krausz, C. (2004) EAA/EMQN best practice guidelines for molecular diagnosis of Y-chromosomal microdeletions. State of the art 2004. International Journal of Andrology, 27, 240-249.
Zitzmann, M. & Nieschlag, E. (2003) The CAG repeat polymorphism within the androgen receptor gene and maleness. International Journal of Andrology, 26, 76-83.
Simental, J.A., Sar, M., Lane, M.V., French, F.S. & Wilson, E.M. (1991) Transcriptional activation and nuclear targeting signals of the human androgen receptor. Journal of Biological Chemistry, 266, 510-518.
Jenster, G., Van der Korput, H.A.G.M., Van Vroonhoven, C., Van der Kwast, T.H., Trapman, J. & Brinkman, A.O. (1991) Domains of the androgen receptor involved in steroid binding transcriptional activation, and subcellular localization. Molecular Endocrinology, 5, 1396-1404.
Chang, C., Kokontis, J. & Liao, S. (1988) Structural analysis of complementary DNA and amino acid sequences of the human and rat androgen receptors. Proceedings of the National Academy of Sciences of the United States of America, 85, 7211-7215.
Hardy, D.O., Scher, H.I., Bogenreider, T., Sabbatini, P., Zhang, Z., Nanus, D.M. & Catterall, J.F. (1996) Androgen receptor CAG repeats lengths in prostate cancer: correlation with age of onset. Journal of Clinical Endocrinology and Metabolism, 81, 4400 -4405.
Kazemi-Esfarjani, P., Trifiro, M.A. & Pinsky, L. (1995) Evidence for repressive function of the long polyglutamine tract in the human androgen receptor: possible pathogenetic relevance for the (CAG)nexpanded neuronopathies. Human Molecular Genetics, 4, 523-527.
Hsing, A.W., Gao, Y.T., Wu, G., Wang, X., Deng, J., Chen, Y.L., Sesterhenn, I.A., Mostofi, F.K., Benichou, J. & Chang, C. (2000) Polymorphic CAG and GGN repeat length in the androgen receptor and prostate cancer risk: a population based case control study in China. Cancer Research, 60, 5111-5116.
Hsiao, P.W., Lin, D., Nakao, R. & Chang, C. (1999) The linkage of Kennedy’s neuron disease to ARA 24, the first identified androgen receptor polyglutamine region-associated coactivator. Journal of Biological Chemistry, 274, 20229-20234.
Heinlein, C.A. & Chang, C. (2002) Androgen receptor (AR) coregulator: an overview. Endocrine Reviews, 23, 175-200.
Harkonen, K., Huhtaniemi, I., Makinen, J., Hubler, D., Irjala, K., Koskenvuo, M., Oettel, M., Raitakari, O., Saad, F. & Pollanen, P. (2003) The polymorphic androgen receptor gene CAG repeat, pituitarytesticular function and andropausal symptoms in ageing men. International Journal of Andrology, 26, 187-194.
Edwards, A., Hammond, H.A., Jin, L., Caskey, C.T. & Chakraborty, R. (1992) Genetic variation at five trimetric and tetrametric tandem repeat loci in four human population groups. Genomics, 12, 241253.
Platz, E., Rimm, E.B., Willet, W.C., Kantoff, P.W. & Giovannucci, E. (2000) Racial variation in prostate cancer incidence and in hormonal system markers among male health professionals. Journal of the National Cancer Institute, 92, 2009-2017.
Rajpert-De Meyts, E., Leffers, H., Petersen, J.H., Andersen, A.G., Carlsen, E., Jorgensen, N. & Skakkebaek, N.E. (2002) CAG repeat length in androgen receptor gene and reproductive variables in fertile and infertile men. Lancet, 359, 44-46.
Thangaraj, K., Joshi, M.B., Reddy, A.G., Gupta, N.J., Chakravarty, B. & Sing, L. (2002) CAG repeat expansion in androgen receptor gene is not associated with male infertility in Indian populations. Journal of Andrology, 23, 815-818.
Tut, T.G., Ghadessy, F.J., Trifiro, M.A., Pinsky, L. & Yong, E.L. (1997) Long polyglutamine tracts in the androgen receptor are associated with reduced trans-activation, impaired sperm production, and male infertility. Journal of Clinical Endocrinology and Metabolism, 82, 3777-3782.