Y. Yamanaka, H. Matsuo, S. MocHizuki, S. Nakago, S. Yoshida and T. Maruo

Department of Obstetrics and Gynecology, Kobe University Graduate School of Medicine, Kobe, Japan

Dr T. Maruo. Department of Obstetrics and Gynecology. Kobe University Graduate School of Medicine, 7-5-1 Kusimoki-cho, Chuo-ku, Kobe 650-0117, Japan;

Abstract

It is clinically evident that administration of estriol (E₃) increases the hone mass density of the lumbar vertebrae in postmenopausal women, and that combined treatment with estrogen and 1,25-dihydroxyvitamin D₃ (VD₃) increases femoral neck bone mass density compared with treatment with estrogen alone in postmenopausal osteoporotic women. However, the molecular mechanism whereby treatment with E₃ affects osteoblast cell function is still unknown, (his study was conducted first to examine the comparative effects of E₃ and VD₂ on the cell viability of cultured human osteoblast-like cells (HOS) and second to determine whetherE₃affects VD₃ receptor inRNA expression in HOS. The cell viability and VD₃ receptor inRXA expression of cultured HOS were assessed by M i l assay and semi- quantitative reverse transcriptase—polymerase chain reaction with Southern blot analysis, respectively. The treatment with Et increased the cell viability of cultured HOS compared with untreated control cultures. The increase in cell viability caused by the treatment with E₃ was further augmented by the combined treatment with VD₃. The addition of either E₃ β.52 X 10^-8 inol/l) or E₃ β.52 X 10^-7 mol/l) to cultured HOS for 24 h resulted in a fourfold and eightfold increase, respectively, in VD₃ receptor mRNA expression in HOS, compared with that in untreated control cultures. These results suggest that E₃ may up-regulate the cell viability of osteoblast cells, and that the concomitant treatment until E₃ and 17β,- further augments the cell viability being associated with an E₃-induced increase in VD₃ receptor mRNA expression in those cells.

Key words: Human Osteoblast-like Cells, 1,25-1 )n iydroxyvitamin D3 Receptor, Crn Viability, Estriol . I7J3-Estraldiol

---

Introduction

The loss of bone mass that occurs in postmenopausal women can be attributed to lack of estrogen. This is confirmed by the clinical observation that postmenopausal osteoporosis can he successfully prevented by estrogen replacement therapy. 17β-Estradiol (E₂) has an important role in the pre-vention of postmenopausal osteoporosis[1,2]. E₂ inhibits bone resorption and stimulates bone formation in the tibia and femur in ovariectomized rats by promoting calcium absorption in the intestine[3,5]. E₂ also exerts an inhibitory effect on bone resorption via the estrogen receptor detected in rat osteoblast-like cells and normal human osteoblasts[6-9]. The suppression of bone resorption is attributed to inhibition ot bonc-rcsorbing cytokine action on bone-marrow stromal cells and osteoblasts[9]. The Ei-induced increase in cell proliferation of osteoblasts might be mediated by insulin-like growth factor 1 (IGF-I), induced by E₃[6,10].

Recently, Tuppurainen et all.[11] showed that combined treatment with and 1,25-dihydroxyvitamin IT (VI T) further increases femoral neck bone mass density in osteoporotic women compared with treatment with E₂ alone. Several reports have shown that Eo increases the number of VD₃ receptors in the rat uterus, liver and kidney, and in human breast cancer cells[12-18]. It has also been reported that E₂increases the number of VD, receptors in the ROS 17/2.8 cell line and the VET receptor mRNA levels in human osteosarcoma cells (MG-63)[19,20].

Estriol E₃ is an estrogen with fewer adverse effects on endometrial proliferation, and it requires no combined use of progestin when used for hormone replacement therapy. For hormone replacement therapy, E₂ is an alternative agent to E₃ [21]. However, the molecular mechanism whereby E₃ affects osteoblast cell function is still unknown. The present study was conducted in order to examine the effects of E₃ on the cell viability of cultured human osteoblast-like cells (HOS). and to determine whether E₃, affects the VD₃ receptor mRNA expression in HOS.

Materials and methods

Materials

VD₃ was purchased from Chugai Pharmaceutical Co., L.td (Tokyo, Japan). E₂ and E₃ were obtained from Sigma (St Louis, MO. USA) and Mochida Pharmaceutical Co., Ltd (Tokyo, Japan), respectively. The sources of other materials used were as follows. Fetal bovine serum (I BS) and Dulbccco’s Modified Eagle Medium (I)MEM) were purchased from Life Technologies, Inc. (Grand Island, NY. USA) and Sigma (St Louis, MO. USA), respectively. Penicillin and streptomycin were obtained from Invitrogen Corp. (Carlsbad. CA, USA). I IOS was purchased from Dainippon Pharmaceutical Co., Ltd (Tokyo, Japan).

Cell culture

HOS was subcultured in 1.0 X 10⁵-mm³ plastic culture flasks at 37°C in a 5% CO₂ humidified atmosphere in phenol-red-free 1 )MEM supplemented w ith 10% dextran-coated charcoal-stripped LBS. penicillin (100 μ/ml) and streptomycin (100 μ/ml). At approximately 60—70% confluence, the cultured medium was stepped down to serum-free conditions by incubating the cells in serum-free DMEM in the absence or presence of E₂ β.67 x 10^-8 mol/l), and β.52Х10^-8 or 3.52 x 10^-7 mol/l) and VIT (10^-9 mol/l) for indicated periods of time (24 h to 72 h).

MTT assay for cell viability

HOS cell number and viability were evaluated by means of the MTT β-(4,5-dimethylthiazol-2-yI) -2,5-diphenyl tetrasolium biomide) assay using the Mosmann method[22]. This assay was based on the cleavage of the tetrazolium salt MTT to a blue formazan product by mitochondrial dehydrogenase in viable cells. Briefly, after being treated in the absence or presence of E₂ β.67 x 10^-8 mol/l), E.) β.52x10^-8 or 3.52x10^-8 mol/l) and VD₃ 10⁹ mol/l) in serum-free DMEM for 24-72 h in 96-well tissue-culture plates, 10μ of MTT (Sigma, St Louis, MO, USA) solution was added to each well, and cultured cells were incubated at 37°C for another 4 h. Then 100μlof isopropanol/HCl solution was added to each well and mixed thoroughly with an EM-36N microtube mixer (Taitec, Tokyo, Japan). The absorbance was measured by an MTP-120 ELISA plate reader (Corona Electric Co., Osaka, Japan) with a test wavelength of 570 nm and a reference wavelength of630 nni. These experiments with FIOS were repeated at least three times with similar results.

Semi-quantitative RT-PCR with Southern blot analysis

The cells were seeded on to 1.0 X 10⁵-mm³ culture plates and cultured into subconfluency (approximately 8 X 10⁴cells/cm²). Thereafter, the cells were stepped down to serum-free conditions by being incubated in serum-free DMEM in the absence or presence of E₂ β.67 x 10^-8 mol/l), or E₃ β.52 X 10^-8 or 3.52 X10^-7 mol/l) for 24-48 h. Total RNA was isolated from HOS cultured by the guanidinium thiocynate and phenol/chlorofonn method. First-strand complementary DNA (cDNA) was synthesized from 4 pg of total RNA using a cDNA synthesis kit (QIAGEN GmbH, Hilden, Germany).

THе polymerase chain reaction (14 R) was performed using 1 ml of CDNA as template, 6.25 pmol/l of each primer, 2.5 mmol/l dNTPs, 0.125 U Taq DNA polymerase (Roche-Diagnostics GmbH, Mannheim, Germany), IX reaction buffer containing 10 mmol/l Tris-HCl, pH 8.3, 50 inmol/l of KC1, 1.5 mmol/l of MgCl₂ and 0.01% gelatin in a reaction volume of 25 ml. The primers that were used to amplify the VD₃ receptor cDNA were 5'- ( :AACAAAGACTACAAGTACCGCGTCAGTC IA-З' (sense) and 5,-GTCIAGGAGGGCTGCTGAGTAG-3/ (antisense)[23]. The sense primer annealed to 982—1011, while antisense corresponded to bases 1471 — 1491 of the VD₃ receptor’s cl )NA. I he length ot the expected OCR product was 510 base pairs (bp). OCR amplification was performed using a Gene Amp PGR System 9600-R (Perkin Elmer Corp., Norwalk. CT, USA). The amplification procedure included an initial dénaturation step at 94°C for 5 min and 30 cycles, as follows: dénaturation step at 94°C for 30 s, annealing step at 55°C for 30 s and extension step at 72°C tor 30 s. The sequence of the primer used to amplify the housekeeping β-actin gene was 5'-CTT CT AC A AT G AGCT GCGT G-3'(sense) and 5'-TC : AT G A( if IT AGT CAGT CAGG-3'(antisense). The sense primer annealed to bases 308—327, while the antisense primer corresponded to bases 593—612 of the beta-actin gene. The length of the expected PCR product was 305 bp. The amplification procedure included an initial dénaturation step at 94°C for 5 min and 15 cycles, as follows: dénaturation step at 94 C for 30 s, annealing step at 55°C for 30 s, extension step at 72°C for 30 s.

To allow the quantification of the VIT receptor inRNA expression. Southern blot analysis was used. The amplified products were electrophoresed on 3% agarose gel, and after dénaturation with alkaline solution they were transferred to a nylon membrane filter for Southern blotting. After transfer, the DNA was fixed by UV irradiation, and hybridization was performed using the 5'-³²P-end-labeled oligonucleotide probe. The conditions for hybridization were prehybridization at 65°C for 2 h and hybridization at 65°C for 18 h. The probe specific for β-actin was prepared with a full-length cl )NA of β-actin labeled with ³²P. The washing conditions were as follows: saline sodium citrate (SCC = 300 mmol/l NaCl and 30 mmol/l trisodium citrate, pH 7.0), 0.1% sodium dodecyl sulfate (SDS) at room temperature for 20 min, performed twice, and SCC β0 mmol/l NaCl and 3 mmol/l trisodium citrate,μl 7.0) and 0.1% SDS at 60°C for 5 min.

After washing, the blot was exposed to X-ray film for 3 h. The film was scanned on ScanJet 3C/ADF (Hewlett Packard, Miami, FL. USA), and the strength of the signal was measured by NIH Image version 1.58. The amount of VD₃ mRNA was expressed relative to the amounts of β-actin mRNA present in each specimen.

Statistical analysis

The data collected are shown as mean values + SD from at least three independent experiments. Statistical significance was evaluated using two-way analysis of variance (ANOVA). Differences with a p-value of < 0.05 were considered to be statistically significant.

Results

Effects of E₂, E₃ and VD₃ on cell viability

The treatment with E₂ β.67 x 10^-8 mol/l) resulted in a significant increase in the cell viability of cultured I IOS compared with untreated control cultures at 24 h exposure, hut did not do so at 48 h or 72 h exposure. The treatment with either E, β.52 X 10^-8 mol/l) or E, β.52 X 10^-7 mol/l) also significantly increased the cell viability of cultured HOS compared with untreated control cultures throughout 24-72 h exposure (Figure l). The treatment with VD₃ (10^-9 mol/l) exerted similar stimulatory effects on cell viability to those observed with E.v β.52 X 10^-8 mol/l). The combined treatment with E₂ β.67 x 10^-8 mol/l) and VD₃ (10^-9 mol/l) further increased the cell viability of cultured I IOS compared with the treatment with E₂ β.67 X 10^-9 mol/l) alone or VD₃ (10^-9 mol/l) alone throughout 24-72 h exposure. The increase in cell viability of cultured HOS caused by the treatment with E; β.52 X 10 s mol/l) alone was also further augmented in response to the concomitant treatment with VD₃ (10^-9 mol/l) at 72 h exposure. Compared with the combined treatment with E; β.52 x 10⁴ mol/l) and VD₃, (10^-9 mol/l), the combined treatment with E₃ β.67 X 10^-9 mol/l) and VD₃ (10^-9 mol/l) had a higher cell viability of cultured HOS at 24 h exposure, hut did not do so at 48 h and 72 h exposure (Table 1).

Table 1. Effects of 17β-cstradiol (E₂). cstriol (E₃) and 1,25-dihydroxyvitamin D₃, VD₃ human osteoblast-like cells (HOS) assessed by MTT assay.

Figure 1. Effects of l7β-cstradiol (E₃) and cstriol (E₃) on the cell viability of cultured human osteoblast-like cells (I JOS) assessed by MTT assay. Treatment with E₃ β.67 X 10^-8 s mol/l) or E, β.52 x 10^-8 or 3.52 x 10^-8 mol/l) alone was carried out for 24-72 h in serum-free conditions. Values are presented as the mean values ± SI) from three independent experiments. *p < 0.05 vs. control cultures.

Effect of E₂ and E₃ on VD₃ receptor mRNA expression

Densitbmetric quantification of 10^-8 receptor mRNA with a molecular basis of 51.0 bp produced by semi-quantitative reverse transcriptase (RTJ-BCR with Southern blot analysis revealed that the treatment with either E₂β.67 x 10^-8 mol/l) alone or E₃ β.52 x 10^-8 or 3.52 x 10^-8 mol/l) alone resulted in a twofold, fourfold and eightfold increase, respectively, in VD₃ receptor mRNA expression in cultured HOS at 24 h exposure compared with untreated control cultures (Figure 2a). By contrast, at 48 h exposure, no such increases in VD₃ receptor mRNA expression in cultured HOS were noted with the treatment with either E₂alone or E₃ alone (Figure 2b).

Figure 2. Effects ot 17-β-estradiol (E₂) or cstriol (E₂) on VD₃ receptor (VDR) mKNA expression in cultured human osteoblast-like cells (HOS) analyzed by semi-quantitative RT-FCR and Southern blot. 1 HOS were exposed to either E₂ β.67 x 10^-8 mol/l) or E₂ β.52 x 10^-8 or 3.52 x 10^-8 mol/l) tor (a) 24 h and (b) 4H h. The amount of mRNA was expressed relative to the abundance of β-actin mRNA. Data are presented as the fold increase over the control value and as the mean values ± SI) from three independent experiments. *p < 0.05 vs. control cultures.

Discussion

This study has demonstrated that the treatment with E₃ increases the cell viability of cultured HOS compared with untreated control cultures, that combined treatment with E₃ and VD₃ increases the mRNA expression in those cells. These findings suggest that E₃ exerts direct effects on osteoblast function, and that an interaction between E₃ and VD₃ receptors occurs in cultured HOS.

Nishibe et nl.[21] showed that the administration of E₃ increases bone mass density of the lumbar vertebrae in postmenopausal women. E₃ has been considered to be an estrogen with a much weaker stimulatory effect on endometrial proliferation. Accordingly, E₃ therapy is associated with less frequent genital bleeding and requires no concomitant use of progestin. Nevertheless, Weiderpass ct itl.[24] have recently reported that oral use of E₃ 1-2 mg daily increases the relative risk of endometrial cancer and endometrial hyperplasia. I hus it is necessary to monitor the endometrium during such treatment with Eu The latter is also referred to as a terminal metabolite or as an impending estrogen, and is known to play a role in the metabolic responses in the target tissues that express the estrogen receptor[25]. E₃ has a sevenfold and a fivefold lower affinity relative to E₂ for the estrogen receptor fx and the estrogen receptor β, respectively-[26]. The relative association constant of E₃ with the estrogen receptor has been reported to be 1 2.5% relative to that of E₂, and the potency of E₃ in inducing positive co-operativity in the estrogen receptor is 50% that of E₂[27]. Onoe ct al.[28] reported that higher levels of estrogen receptor β mRNA compared with estrogen receptor a mRNA are expressed in rat calvaria cells and ROS 17/2.15. E₃ has a higher affinity for estrogen receptor β than for estrogen receptor. Interestingly, in the present study the treatment with E₃ increased the cell viability of cultured I IOS in a similar manner to the treatment with E₂. Furthermore, it is worth noting that E₃ treatment produced a greater increase in VD₃ receptor mRNA expression in cultured HOS compared with E₂ treatment. We have also noted that E₃ treatment augments the proliferative activity of cultured HOS assessed by bromodeoxyuridine uptake as much as E₂ treatment (unpublished data). It is therefore likely thatE₂may be an effective alternative to E₂ for preventing loss of bone mineral density in postmenopausal women.

It has become evident that not only VD₃ but also E₃ regulates the number of VET receptors through its own specific receptor[29-31]. Several investigators have reported that E₂ increases the amount of both VD₃ receptor mRNA and protein in human and rat bone cells. Liel et al.[19] showed that E₂ treatment results in a twofold increase in the number of VD₃ receptors in rat osteosarcoma-derived osteoblast-like cells. ROS 17/2.8. Mahonen et al.[20] reported that E₂ stimulates VD₃ receptor mRNA expression in human osteosarcoma cells. In their studies, the addition of E₂ at a concentration of 10⁴ mol/l increases VIreceptor expression in various cells. The present study has demonstrated that treatment with either E₂ or E₃ increases VD₃ receptor mRNA expression in cultured HOS compared with that in untreated control cultures. It is likely that the effects of E₂ on bone may be mediated at least in part through its action on VD₃ receptor mRNA expression, followed by an increase in the sensitivity of osteoblasts to VD₃. Understanding the mechanism of E₃ action on the bone should encourage much wider investigation of its potential clinical use in populations of different ethnic origin, although most of the studies on E₃ action were carried out in Japanese women.

Steroid and nuclear receptor coactivators have been implicated in the regulation of nuclear receptor function by enhancing ligand-dependent transcriptional activation of target gene expression32. A number of coactivator molecules of the steroid receptor coactivator/nuclear receptor coactivator family interact with activation functions within nuclear receptors through a conserved region containing helical domains of a core LXXLL sequence, and thus participate in transcriptional regulation [33]. A recent study has shown that the VD₃ receptor and estrogen receptor β interact with different CX-helical LXXLL motifs of receptor-associated coactivator 3[32]. Thus it is possible to speculate that Ev-bound nuclear receptors recruit coactivators, including receptor-associated coactivator 3[32], and enhance the ligand-dependent transcriptional activation of VD₃ receptor mRNA expression. It seems likely that the combined treatment with E₃ and VD₃ a augments the cell viability of cultured HOS as much as the combined treatment with E₃ and VD₃. However, the molecular mechanism whereby E₃ affects VD₃ receptor mRNA expression in cultured HOS is still unknown.

In conclusion, we have demonstrated that E₃ treatment increases the cell viability of cultured HOS compared with untreated control cultures. Combined treatment with E₃ and VD₃ further increases the cell viability of cultured HOS compared with treatment with E₃ alone, and E₃ treatment also results in a substantial increase in VD₃ receptor mRNA expression in cultured I IOS compared with untreated control cultures. Although the biological role of E₃ in bone cells has yet to be explored, the present study moves toward a better understanding of the molecular mechanisms underlying the clinical effects of E₃ alone or combined therapy with E₃ and VD₃ in the maintenance of bone density in postmenopausal women.

Acknowledgements

This research was supported in part by Grant-in-Aid for Scientific Research No. 11671619 from the Japanese Ministry of Education, Science and Culture and by the Japan Association of Obstetricians and Gynecologists Ogyaa-Donation Foundation yODF).

---

References

Lindsay R. Sex steroids in the pathogenesis and prevention of osteoporosis. In Liggs BL. Melton LJ III, eds. Osteoporosis Etiology, Diagnosis and Management. New York: Raven Press, 1988:333—58 

Gallagher JC, Goldgar L). Treatment of postmenopausal osteoporosis with high doses of synthetic calcitriol. Ann Intern Med 1990;113:649-55 

PcnslerJM, Rodosevich JA, Higbee R, et al. Osteoclasts isolated from membranous bone in children exhibit nuclear estrogen receptors. J Bone Miner Res 1990;5:797-802 

Ishibe M, Ishibc Y, Fshibashi T, et al. Low content of estrogen receptors in human giant cell tumors of bone. Arch Orthop Trauma Surg 1994:1 13:106—9 

Aarjmandt BH, Salih MA. Herbert DC. et al. Evidence for estrogen receptor-linked calcium transport in the intestine. Bone Miner 1993:21:63-74 

Komm BS, Terpening CM, Benz 1)J, et al. Estrogen binding, receptor mRNA, and biological responses in osteoblast-like osteosarcoma cells. Science 1988;241: 81-3 

Eriksen EF. Colvard DS, lk-rg NJ, et al. Evidence of estrogen receptors in normal human osteoblast-like cells. Science 1988;241:84-6 

Turner KT. Riggs BL. Spelsberg TC. Skeletal effects of estrogen, Endocr Rev 1994;15:275-300 

Manolagas SC.Jilka RL.. Bone marrow, cytokines and bone remodeling: emerging insights into the pathophysiology of osteoporosis. i\ Engl] Med 1995;332: 305-11 

1(1. Ernst M. Heath JK. Rondan GA. Estradiol effects on proliferation, messenger ribonucleic acid for collagen and insulin-like growth factor-1, and parathyroid hormone-stimulated adenylate cyclase activity in osteoblastic cells from calvariac and long bones. Endocrinology 1989; 125:825—33 

Tuppurainen MT, Komulainen M, Kroger I 1, cl al. Does vitamin D strengthen the increase in femoral neck BMD in osteoporotic women treated with estrogen? Osteoporos hit 1998;7:32-8 

Walters MR. An estrogen-stimulated 1,25-di hydro xy- vitamin I T receptor in rat uterus. Biochem Biophys Res Comm tin 1981 ;13:721—6 

Levy J, Zuili I, Yankowitz N. et al. Induction of cytosolic receptors for 1C/.. 25-dihydroxyvitamin Dun the immature rat uterus by oestradiol. / Endocrinol 1984:129:2318-24 

Duncan WE, C»lass AR, Wray HE. Estrogen regulation of the nuclear 1,25-dihydroxyvitamin IT receptor in rat liver and kidney. Endocrinology 1991;129:2318-24 

Escaleria MTF, Sonohara S, Brentani MM. Sex steroids induced up-regulation of 1,25-(OH)2 vitamin IT receptors in T 47D breast cancer cells. / Steroid Biochem Mol Biol 1993;45:257-63 

Levy J, Zuili 1, Yankowitz N. et al. Induction of cytosolic receptors for lot.25 dihydroxyvitamin IT in the immature rat uterus by oestradiol. / Endocrinol 1984;100:265-9 

Walters MR. An estrogen-stimulated 1,25- dihydroxy vitamin IT receptor in rat uterus. Biochem Biophys Res Connnnn 1981;103:721-6 

Duncan WE. Glass AR. Wray HL. Estrogen regulation of the nuclear 1,25-dihydroxyvitamin IT receptor in rat liver and kidney. Endocrinology 1991;129:2318-24 

Liel Y. Kraus S, Levy J, et al. Evidence that estrogens modulate activity and increase the number of 1,25-dihydroxyvitamin D.v receptors in osteoblastlike cells (ROS 17/2.8). Endocrinology 1992:130: 2597-601 

Mahonen A, Birkanen A. Maenpaa PH. Homologous and heterologous regulation of 1,25-dihydroxy- vitamin IT receptor mRNA levels in human osteosarcoma cells. Biochem Biophys Acta 1991; 1088:1111-18 

Nishibe A. Morimoto S. Hirata K. Comparison of effect of estriol on bone mineral density of vertebrae between elderly and postmenopausal women .J Bone Miner Metab 1998;16:21-6 

Mosman T. Rapid colorimetric assay of cellular growth and survival: application to proliferation and cytotoxicity assays. / Immunol Methods 1983;65:55-63 

Matsuyama T, Ishii S, Tokita A. et al. Vitamin D receptor genotypes and bone mineral density. Lancet 1995;345:1238-9 

Weiderpass E, Baron JA, Adami HO. et al. Low- potency oestrogen and risk of endometrial cancer: a case—control study. Lancet 1999;353:1824-8 

Esposito G. Estriol: a weak estrogen or a different hormonE₃ Gynecol Endocrinol 1991;5:131-53 

Kuiper G. Carlsson B. Grandien K, et al. Comparison of ligand-binding specificity and transcript tissue distribution of estrogen receptors a. and |1 Endocrinology 1997; 138:863-7() 

Melamed M. Castano E, Notides AC. et al. Molecular and kinetic basis for the mixed agonist/antagonist activity of estriol. Mol Endocrinol 1997; 11:1868-78 

Onoe Y. Miyaura C, Ohta H. et al. Expression of estrogen receptor beta in rat bone. Endocrinology 1997;138:4509-12 

Pernalete N. Mori T. Nishii Y. et al. The activity of 22-oxacalcitriol in osteoblast-like (ROS 17/2.8) cells. Endocrinology 1991; 129:778-84 

Strom M. Sandgren ME. Brown TA. et al. 1,25-dihydroxyvitamin IT up-regulates the 1,25- dihydroxyvitamin IT receptor in vivo. Proc \atI Acad Sci l 'SA 1989;86:9770-3 

Ishibe M, Nojima T, Ishibashi T, et al. I7-Beta- estradiol increases the receptor number and modulates the action of 1.25-dihydroxyvitamin IT in human osteosarcoma-derived osteoblast-like cells. Calcif Tissue hit 1995;57:430-5 

Leo CL Li H. Chen JD. Differential mechanisms of nuclear receptor regulation by receptor-associated coactivator 3. / Biol Chem 2000;275:5976-82 

Northrop JP. Nguyen D. Piplani S, et al. Selection of estrogen receptor (1- and thyroid hormone receptor (i-specific coactivator-mimetic peptide using recombinant peptide libraries. Mol Endocrinol 2000; 14:605-22